Recombinant:Article Title: Harnessing the E3 ligase SPOP for targeted degradation of the NUP98::KDM5A fusion oncoprotein.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD11b/Mac-1 BV421 (clone M1/70) Mouse mAb Biolegend Cat#101202; RRID:AB_312785 Gr-1/Ly6C BV421 (clone RB6-8C5) Mouse mAb Biolegend Cat#108433; RRID:AB_10900232 CD117/c-Kit BV421 (clone 2B8) Mouse mAb Biolegend Cat#105827; RRID:AB_10898120 Annexin V Kit PE Conjugate ThermoFisher Cat#88-8102-72; RRID:AB_2575183 V5-Tag (D3H8Q) Rabbit mAb Cell Signaling Cat#13202; RRID:AB_2687461 NUP98 (L205) Rabbit mAb Cell Signaling Cat#2288; RRID:AB_561204 β-Actin (8H10D10) Mouse mAb Cell Signaling Cat#3700; RRID:AB_2242334 SPOP Rabbit pAb Proteintech Cat#16750-1-AP; RRID:AB_2756394 OLLAS Epitope Tag (L2) Rat mAb Novus Bio CatNBP1-06713; RRID:AB_1625979 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat#7076; RRID:AB_330924 Nuclear Orange Cayman Chemical 25174 Chemicals, peptides, and recombinant proteins SPOP-IN-6b MedchemExpress HY-122615 MLN7243 (TAK-243) MedchemExpress HY-100487 MLN4924 (Pevonedistat) MedchemExpress HY-70062 MG132 MedchemExpress HY-13259 L-Glutamine Gibco 25030081 Penicillin-Streptomycin Gibco 15140122 Fetal Bovine Serum Biowest S1810 Blasticidin S HCl InvivoGen ant-bl-05 Polybrene Sigma Aldrich TR-1003-G Doxycycline hyclate Sigma Aldrich D9891 Neomycin (G418) InvivoGen ant-gn-5 Trypsin-EDTA (0.05%) ThermoFisher 25300054 rCutSmart Buffer NEB B6004S BsmBI-v2 NEB R0739S XhoI NEB R0146S Polyethyleneimine (PEI) Sigma Aldrich 408727 SsoAdvanced Universal SYBR Green Supermix BioRad 1725271 RPMI 1640 Gibco 11875093 DMEM, high glucose, no glutamine Gibco 11960044 Critical commercial assays Q5 Site-Directed Mutagenesis Kit NEB E0554S Monarch® Total RNA Miniprep Kit NEB T2010S ClarityTM Western ECL Substrate BioRad 1705060 Deposited data HEK293T NUP98::KDM5A RNA sequencing This manuscript GEO: GSE297415 murine AML SPOP-PROTAC vs. .. Empty Vector RNA sequencing This manuscript GEO: GSE297415 Tet-Off model of NUP98::KDM5A-driven murine AML cells RNA sequencing Schmoellerl et al.26 GEO: GSE134784 Mass spectrometry for the interactors of NUP98 and NUP98 oncofusions Terlecki-Zaniewicz et al.19 PRIDE: PXD022518 (Continued on next page) 16 Cell Reports 44, 116602, December 23, 2025
Article Title: A combined enteric neuron-gastric tumor organoid reveals metabolic vulnerabilities in gastric cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-ACC1 Cell Signaling Cat#4190S; RRID: AB_10547752 Rabbit anti-SREBP1 Abcam Cat#ab28481; RRID: AB_778069 Rabbit anti-MLKL Abcam Cat#184718; RRID: AB_2755030 Rabbit anti-MLKL (phospho S358) Abcam Cat#187091; RRID: AB_2619685 Rabbit anti-ARHGAP26 Atlas Antibodies Cat#HPA035107; RRID: AB_10669855 Mouse anti-neuron-specific beta-III tubulin R&D systems Cat#MAB1195; RRID: AB_357520 Rabbit anti-TrkC (C44H5) Cell Signaling Cat#3376; RRID: AB_2155283 Rabbit anti-MAP2 Cell Signaling Cat#4542; RRID: AB_10693782 Rabbit GAPDH (14C10) Cell Signaling Cat#2118; RRID:AB_561053 PE/Cyanine7 anti-human CD49d antibody BioLegend Cat304313; RRID: AB_10642817 Anti-rabbit IgG, HRP-linked antibody Cell Signaling Cat#7074; RRID: AB_2099233 Goat anti-Mouse IgG (H+L) Cross-absorbed secondary antibody, Alexa Fluor TM 488 ThermoFisher Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H+L)Cross-absorbed secondary antibody, Alexa Fluor TM 568 ThermoFisher Cat#A-11011; RRID: AB_143157 ProLong TM Gold Antifade Mountant with DNA stain DAPI Invitrogen Cat#P36941; RRID: AB_2629482 Chemicals, peptides, and recombinant proteins Advanced DMEM/F12 Gibco Cat#12634010 RPMI 1640 Gibco Cat#11875093 DMEM Gibco Cat#10569010 Trypsin-EDTA Gibco Cat#25200072 HEPES Gibco Cat#15630080 GlutaMAX Gibco Cat#35050061 Penicillin-Streptomycin Gibco Cat#15140122 B-27 Supplement Gibco Cat#17504001 N-Acetyl-L-cysteine Sigma-Aldrich Cat#A9165 [Leu15]-Gastrin I human Sigma-Aldrich Cat#G9145 Recombinant Human EGF Gibco Cat#PHG0313 Recombinant Human FGF10 PeproTech Cat#100-26 Recombinant Human R-Spondin-1 PeproTech Cat#120-38 Recombinant Human Noggin PeproTech Cat#120-10C WNT Surrogate-Fc Fusion Protein IpA Cat#N001 A83-01 Tocris Cat#2939/10 Y-27632 Tocris Cat#1254/10 Cultrex Reduced Growth Factor Basement Membrane Extract, Type 2 (BME) R&D systems Cat#3533-005-02 TrypLE TM Select Gibco Cat#12563029 Matrigel Corning Cat#354277 mTESR1 StemCell Technologies Cat#85857 ReLeSR StemCell Technologies Cat#100-0484 Neurobasal medium Gibco Cat#21103049 BMP4 R&D systems Cat#314-BP-010 SB431542 R&D systems Cat#1614/10 CHIR99021 Tocris Cat#4423 Retinoic acid Tocris Cat#0695 (Continued on next page) e1 Cell Stem Cell 32, 1–19.e1–e10, October 2, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER DMH-1 Tocris Cat#4126 Essential 6 medium Gibco Cat#A1516401 CTS TM N-2 supplement Gibco Cat#A1370701 MEM Non-essential amino acids solution Gibco Cat#11140050 Recombinant human GDNF Peprotech Cat#450-10 FGF2 Stemgent Cat#03-0002 Accutase Life Technologies Cat#A11105-01 Poly-L-ornithine Merck Cat#P4957 Geltrex LDEV-Free, hESC-Qualified, reduced growth factor basement membrane matrix Gibco Cat#A1413302 Zeocin TM Invitrogen Cat#R25001 Puromycin InvivoGen Cat#ant-pr-1 Ampicillin Gold Biotechnology Cat#A30125 Opti-MEMTM Gibco Cat#31985070 PEI transfection reagent MedChemExpress Cat#HY-K2014 Dimethyl sulfoxide Sigma-Aldrich Cat#D2650 5-Fluorouracil Sigma-Aldrich Cat#F6627 IACS-010759 Cayman Cat#25867 IM-156 Cayman Cat#34763 ND630 Cayman Cat#23961 ND646 Cayman Cat#34764 Ro 48-8071 fumarate MedChemExpress Cat#HY-18630A MG-132 Sigma-Aldrich Cat#474790 Rotenone Cayman Cat#13995 TVB-2640 Cayman Cat#35703 BSA Control for BSA-Fatty Acid Complexes Cayman Cat#29556 BSA-Palmitate Saturated Fatty Acid Complex Cayman Cat#29558 BSA-Oleate Monounsaturated Fatty Acid Complex Cayman Cat#29557 Acetylcholine Merck Cat#A2661 Acetate Millipore Cat#567422 Serotonin hydrochloride MedChemExpress Cat#HY-B1473 GABA MedChemExpress Cat#HY-N0067 Dopamine hydrochloride MedChemExpress Cat#HY-B0451A VIP MedChemExpress Cat#HY-P1023 Neuropeptide Y MedChemExpress Cat#HY-P1601 Substance P MedChemExpress Cat#HY-P0201 TNF-α MedChemExpress Cat#HY-P1860 QuickExtractTM DNA Extraction Solution Biosearch Technologies Cat#QE09050 D-Luciferin, Potassium Salt Gold Biotechnology Cat#LUCK-1G Tween 80 Sigma-Aldrich Cat#P1754 PEG 400 Polysciences Cat#25322-68-3 Pierce ECL Western Blotting Substrate Thermo Scientific Cat#32106 Critical commercial assays MiniBEST Plasmid Purification Kit TaKaRa Cat#9760 Plasmid Midi Kit QIAGEN Cat#12145 DNeasy Blood & Tissue Kit QIAGEN Cat#69506 MiniBEST Universal RNA Extraction Kit TaKaRa Cat#9767 Agencourt AMPure XP beads Beckman Coulter Cat#A63881 Cell titer-Glo® Luminescent Cell Viability Assay Promega Cat#G7572 Kapa HiFi HotStart ReadyMix Kapa Biosystems Cat#KK2602 (Continued on next page) Cell Stem Cell 32, 1–19.e1–e10, October 2, 2025 e2
Article Title: Origin of Ewing sarcoma by embryonic reprogramming of neural crest to mesoderm.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CD99 Abcam ab108297; RRID:AB_10862996 Anti-FLI1 Abcam ab15289; RRID:AB_301825 Anti-GFP Cell Signaling mAb#2955; RRID:AB_1196614 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling 7074 S; RRID:AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling 7076 S; RRID:AB_330924 Anti-FLAG® Purified Immunoglobulin Mouse Monoclonal Antibody [M2] Millipore Sigma F3165; RRID:AB_259529 Alexa Fluor Plus 488 Goat anti-Mouse IgG Thermo Fisher A32723; RRID:AB_2633275 Alexa Fluor 546 Donkey anti-Rabbit IgG Thermo Fisher A10040; RRID:AB_2534016 Bacterial and virus strains One Shot TOP10 Chemically Competent E. coli Thermo Fisher C404003 Chemicals, peptides, and recombinant proteins Phenol Red Solution Sigma P0290-100mL 4% Paraformaldehyde Phosphate Buffer Solution FUJIFILM Irvine Scientific 163–20145 UltraPure 0.5M EDTA, pH 8.0 Thermo Fisher 15575020 Trilogy MilliporeSigma 920P Accumax TM solution Millipore Sigma (Sigma Aldrich) A7089 HEPES Buffer 0.5M, pH 8.0 Boston BioProducts BB-2080 10x HBSS Santa Cruz Biotechnology sc-391061 Bovine Serum Albumin (BSA) Millipore Sigma (Sigma Aldrich) A6003 RNAscope Probe: Hs-EWSR1-FLI1-No-XDr-C1 ACDBio Cat No. 1106251-C1 RNAscope Probe: Hs-EWSR1-FLI1-No-XDr-C4 ACDBio Cat No. 1106251-C4 RNAscope Probe: RNAscope Probe: EGFP-C1 ACDBio Cat No. 538851-C1 RNAscope Probe: Dr-ta-C1 ACDBio Cat No. 483511-C1 RNAscope Probe: Dr-ta-C2 ACDBio Cat No. 483511-C2 RNAscope Probe: Dr-nkx2.2a-C2 ACDBio Cat No. 529751-C2 RNAscope Probe: Dr-hoxd13a-C2 ACDBio Cat No. 1191371-C2 RNAscope Probe: Dr-hoxa13b-C2 ACDBio Cat No. 1129201-C2 RNAscope Probe: Dr-isl2b-C2 ACDBio Cat No. 1164341-C2 RNAscope Probe: Dr-neurog1-C2 ACDBio Cat No. 505081-C2 RNAscope Probe: Dr-elavl4-C2 ACDBio Cat No. 1056151-C2 RNAscope Probe: Dr-tbx5a-C3 ACDBio Cat No. 1183271-C3 RNAscope Probe: Dr-tbx4-C4 ACDBio Cat No. 1207821-C4 RNAscope Probe: Dr-fgf8a-C3 ACDBio Cat No. 559351-C3 RNAscope Probe: Dr-sox10-C3 ACDBio Cat No. 444691-C3 RNAscope Probe: Dr-fgf10b-C3 ACDBio Cat No. 812171-C3 RNAscope Probe: Dr-fgf10a-C4 ACDBio Cat No. 1090101-C4 RNAscope Probe: Dr-eomesa-C4 ACDBio Cat No. 1241641-C4 Opal 520 Akoya Biosciences FP1487001KT Opal 570 Akoya Biosciences FP1488001KT Opal 620 Akoya Biosciences FP1495001KT Opal 690 Akoya Biosciences FP1497001KT Critical commercial assays RNAscope Fluorescent Multiplex V2 Assay ACDBio Cat. No. 323100 (Continued on next page) Cell Reports ▪▪, 116376, ▪▪, 2025 17 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER CUT&RUN Assay Kit Cell Signaling #86652 Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle, 16 rxns 10xGENOMICS PN-1000283 Chromium Next GEM Chip J Single Cell Kit, 16 rxns 10xGENOMICS 1000230 LR Clonase TM II Plus enzyme Thermo Fisher Scientific 12538120 Gateway TM BP Clonase TM II Enzyme mix Thermo Fisher Scientific 11789020 mMESSAGE mMACHINE TM SP6 Transcription Kit Thermo Fisher AM1340 SignalStain DAB Substrate Kit Cell Signaling 8059 QIAprep Spin Miniprep Kit (250) Qiagen 27106 Deposited data Raw and analyzed data: single cell RNA and ATACseq This paper GEO: GSE63473 Raw and analyzed data: CUT&RUN This paper GEO: GSE306234 Experimental models: Organisms/strains Ubi:loxP-DsRed-STOP-loxP-GFP-2A-EF1 James Amatruda’s Lab 19 This paper − 28.5Sox10:Cre; actab2:loxP-BFPSTOP-loxP-DsRed (Sox10>dsRed) Gage Crump’s Lab N\A WIK Wild-type ZIRC N\A Oligonucleotides Morpholino: tfap2a-201e4i4 5 ′ - ACAATGAAGATCCAGCTCACCTCCT -3’ Gene Tools This Paper Morpholino: foxd3-MO 5 ′ UTR 5 ′ - CACCGCGCACTTTGCTGCTGGAGCA -3 ′ Gene Tools https://zfin.org/ZDB-MRPHLNO-060522-7 Morpholino: foxd3-MO AUG 5 ′ - CACTGGTGCCTCCAGACAGGGTCAT -3 ′ Gene Tools https://crick.zfin.org/ZDB-MRPHLNO-051220-1 Recombinant DNA pENTR5’_ubi Addgene #27320 pTol2-ubi-DsRed-stop-GFP-2A-EWSR1:FLI1 James Amatruda’s Lab 19 N/A pCS2FA Chi-Bin Chien Lab N/A pCS2-Cre.zf1 Addgene #61391 -pTol2-4.9 sox10:mTagBFP-polyA James Amatruda’s Lab This paper pTol2-4.9 sox10:Cre James Amatruda’s Lab This paper pTol2-HumanPeak-tbxtPP:mTagBFP2 James Amatruda’s Lab This paper pTol2 -tbxtPP:mTagBFP2 James Amatruda’s Lab This paper Software and algorithms Leica LAS Leica N\A Cellranger RNA 6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Cellranger ARC 2.0.0 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger-arc/latest Cellranger ATAC 2.0.0 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger-atac/latest R 4.1.3 N\A https://www.R-project.org/ Seurat 4.3.0 Stuart and Butler et al. 67 https://satijalab.org/seurat/ Signac 1.6.0 Stuart et al. 68 https://stuartlab.org/signac/ HOMER Heinz et al. 69 http://homer.ucsd.edu/homer/motif/ BEDTools Quinlan et al. 70 https://bedtools.readthedocs.io/en/latest/ SAMtools Danecek et al. 71 https://github.com/samtools/samtools GCC 8.3.0 N\A https://gcc.gnu.org/ Bowtie2 2.5.0 Langmead et al. 72 N\A (Continued on next page) 18 Cell Reports ▪▪, 116376, ▪▪, 2025 OPEN ACCESS
Article Title: Structural determinants of DANGEROUS MIX 3, an alpha/beta hydrolase that triggers NLR-mediated genetic incompatibility in plants.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-HA-Peroxidase Roche Cat # 12013819001, clone 3F10; RRID:AB_390917 Monoclonal ANTI-FLAG M2-Peroxidase (HRP) Sigma-Aldrich Cat # A8592; RRID:AB_439702 Myc-Tag (71D10) Rabbit mAb (HRP Conjugate) Cell Signaling Cat # 14038; RRID:AB_2798372 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat # 7074P2; RRID:AB_2099233 DYKDDDDK Tag Antibody Cell Signaling Cat # 2368S; RRID:AB_2217020 Anti-FLAG M2 Affinity gel Sigma-Aldrich Cat # 2220; RRID:AB_10063035 Myc-Trap Agarose ChromoTek Cat # yta-20; RRID:AB_2631369 EZview Red Anti-HA Affinity Gel Merck Cat #E6779; RRID:AB_10109562 Bacterial and virus strains Escherichia coli (E. coli) DH5α competent cell Lab stock N/A Rhizobium radiobacter (Agrobacterium tumefaciens) GV3101 Lab stock N/A E. coli BL21(DE3) RILP Lab stock N/A Chemicals, peptides, and recombinant proteins Ni-NTA resin Qiagen Cat #302030 Imidazole Bio-basic Cat #IB0277 Anti-DYKDDDDK G1 Affinity resin GenScript Cat #L00432-25 FLAG peptide Apeptide custom-made TEV protease Lab stock N/A 1GC400 copper grid GraticulesOptics 1GC400 graphene oxide Sigma-Aldrich Cat # 777676 SYPRO Orange dye Thermo Fisher Scientific Cat #S6650 L-proline-7-amido-4-methylcoumarin hydrobromide Merck Cat # 115388-93-7 KOD-plus-Neo DNA polymerase TOYOBO TOKOD-201 Gateway LR Clonase II Enzyme mix Thermo Fisher Scientific Cat # 11791020 T5 Exonuclease NEB Cat #M0363 cOmplete, EDTA-free Protease Inhibitor Cocktail Roche Cat # 11873580001 Clarity Max Western ECL Substrate Bio-Rad Cat # 1705062 Pierce 3x DYKDDDDK Peptide Thermo Fisher Scientific Cat # A36805 2x Myc-peptide ChromoTek Cat # 2yp HA peptide Thermo Fisher Scientific Cat # 26184 NativePAGE Sample Buffer (4X) Thermo Fisher Scientific BN2003 NativePAGE 5% G-250 Additive Thermo Fisher Scientific BN2004 NativePAGE 4–16% Bis-Tris protein gel Thermo Fisher Scientific BN1002BOX BN1004BOX NativeMark Unstained protein standard Thermo Fisher Scientific LC0725 Nicotinamide 1,N 6 -ethenoadenine dinucleotide Sigma-Aldrich Cat #N2630 Bovine Serum Albumin Standard Ampules Thermo Fisher Scientific Cat # 23209 2 ′ cADPR Biolog Cat #C406 3 ′ cADPR Biolog Cat #C404 Critical commercial assays QuikChange Site-Directed Mutagenesis Kit Strategene N/A (Continued on next page) e1 Molecular Cell 85, 2776–2795.e1–e8, July 17, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data DM3 Col-0 structure This paper 8JGN DM3 Hh-0 structure This paper 8JGM DM3 Col-0 EM map This paper EMD-36240 DM3 Hh-0 EM map This paper EMD-36239 FASTA, scripts of Figure 1 This paper https://doi.org/10.5281/zenodo.15671676 Experimental models: Organisms/strains N. benthamiana (Nb) Lab stock N/A Nb-eds1 Ordon et al., 2017 91 N/A Nb-nrg1 Ordon et al., 2017 91 N/A Arabidopsis: Col-0, Bla-1, Hh-0 Lab stock N/A Bla-1 dm3 This paper N/A pECNUS_JC28 in Bla-1 (Bla-1 eds1) This paper N/A 35S::DM3 Hh-0 -FLAG+pAlcA::DM2h Bla-1 - Myc in Col-0 This paper N/A pAlcA::DM2h Bla-1 -Myc in Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Y460E V484E in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 in Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A in Col-0 This paper N/A dm3 ABRC GABI_615G01 endogenous promoter::DM3 Hh-0 - FLAG/dm3 This paper N/A endogenous promoter::DM3 Col-0 - FLAG/dm3 This paper N/A Oligonucleotides Primers for cloning, see Table S2 Integrated DNA Technologies, Inc N/A Recombinant DNA pGWB514-35S::DM3 Hh-0 -HA This paper N/A pGWB514-35S::DM3 Col-0 -HA This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Y460E V484E This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 ΔC This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332R This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Q345R This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332R Q345R This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 S214A This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 S214A This paper N/A pGWB514-35S:: ΔTP DM3 Hh-0 -HA This paper N/A (Continued on next page) Molecular Cell 85, 2776–2795.e1–e8, July 17, 2025 e2
Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-p-S6K (Thr389) Cell Signaling Cat# 9234; RRID: AB_2269803 Rabbit anti-S6K Cell Signaling Cat# 2708; RRID: AB_390722 Rabbit anti-p-S6 Ribosomal Protein (Ser235/236) Cell Signaling Cat# 4857; RRID: AB_2181035 Rabbit anti-S6 Ribosomal Protein Cell Signaling Cat# 2217; RRID: AB_331355 Rabbit anti-p-4EBP1 (Thr37/46) Cell Signaling Cat# 2855; RRID: AB_560835 Rabbit p-ULK1 (Ser757) Cell Signaling Cat# 14202; RRID: AB_2665508 Rabbit anti-FoxO1 Cell Signaling Cat# 2880; RRID: AB_2106495 Rabbit anti-LC3B Sigma Aldrich Cat# L7543; RRID: AB_796155 Mouse anti-puromycin, clone 12D10 Millipore Cat# MABE343; RRID: AB_2566826 Rabbit anti-Ubiquitin Cell Signaling Cat# 3933; RRID: AB_2180538 Rabbit anti-Ubiquitin Cell Signaling Cat# 58395; RRID: AB_3075532 Rabbit anti-GAPDH Cell Signaling Cat# 2118; RRID: AB_561053 Mouse anti-MyHC DSHB Cat# MF-20; RRID: AB_2147781 Mouse anti-MyHC type IIb DSHB Cat# BF-F3; RRID: AB_2266724 Rat anti-Laminin α2 Santa Cruz Cat# sc-59854; RRID: AB_784266 Anti-Rabbit IgG, HRP-linked Antibody Cell Signaling Cat# 7074; RRID: AB_2099233 Anti-Mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID: AB_330924 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor TM 568 Thermo-Fisher Cat# A11004; RRID: AB_2534072 Goat Anti-Mouse IgM (Heavy chain) Cross-Adsorbed Secondary Antibody, Alexa Fluor TM 488 Thermo-Fisher Cat# A21042; RRID: AB_2535711 Goat anti-Rat IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor TM 568 Thermo-Fisher Cat# A11077; RRID: AB_2534121 Chemicals, peptides, and recombinant proteins 4%-Paraformaldehyde Phosphate Buffer Solution Nacalai Tesque Cat# 09154-85 Tween 20 Nacalai Tesque Cat# 35624-15 Goat serum Sigma-Aldrich Cat# 9023 Triton X-100 Nacalai Tesque Cat# 35501-15 DAPI Fluoromount-G® SouthernBiotech Cat# 0100-20 Isopentane Nacalai Tesque Cat# 26405-65 M.O.M. .. Immunodetection Kit, Basic Vector Cat# BMK-2202 Fluoro-KEEPER Antifade Reagent, Non-Hardening Type with DAPI Nacalai Tesque Cat# 12745-74 RIPA Lysis Buffer cocktail Merck Cat# 20-188 Protein inhibitor cocktail Nacalai Tesque Cat# 25955-24 Sodium orthovanadate Sigma-Aldrich Cat# S6508 Phenylmethylsulfonyl fluoride Nacalai Tesque Cat# 27327-81 Dimethy Sulfoxide Nacalai Tesque Cat# 13445-45 1 mL Syringe Terumo Cat# SS-01T Pierce TM BCA Protein Assay Kits Thermo-Fisher Cat# 23227 Sample Buffer Solution without 2-ME(2x) for SDS-PAGE Nacalai Tesque Cat# 30567-12 Dithiothreitol Sigma-Aldrich Cat# D9779 Methanol Nacalai Tesque Cat# 21914-03 MagicMark TM XP Western Protein Standard Thermo Fisher Cat# LC5602 Precision Plus Protein TM Dual Color Standards Bio-Rad Cat# 1610374 (Continued on next page) Cell Reports 44, 116097, August 26, 2025 17
SYBR Green Assay:Article Title: Harnessing the E3 ligase SPOP for targeted degradation of the NUP98::KDM5A fusion oncoprotein.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD11b/Mac-1 BV421 (clone M1/70) Mouse mAb Biolegend Cat#101202; RRID:AB_312785 Gr-1/Ly6C BV421 (clone RB6-8C5) Mouse mAb Biolegend Cat#108433; RRID:AB_10900232 CD117/c-Kit BV421 (clone 2B8) Mouse mAb Biolegend Cat#105827; RRID:AB_10898120 Annexin V Kit PE Conjugate ThermoFisher Cat#88-8102-72; RRID:AB_2575183 V5-Tag (D3H8Q) Rabbit mAb Cell Signaling Cat#13202; RRID:AB_2687461 NUP98 (L205) Rabbit mAb Cell Signaling Cat#2288; RRID:AB_561204 β-Actin (8H10D10) Mouse mAb Cell Signaling Cat#3700; RRID:AB_2242334 SPOP Rabbit pAb Proteintech Cat#16750-1-AP; RRID:AB_2756394 OLLAS Epitope Tag (L2) Rat mAb Novus Bio CatNBP1-06713; RRID:AB_1625979 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat#7076; RRID:AB_330924 Nuclear Orange Cayman Chemical 25174 Chemicals, peptides, and recombinant proteins SPOP-IN-6b MedchemExpress HY-122615 MLN7243 (TAK-243) MedchemExpress HY-100487 MLN4924 (Pevonedistat) MedchemExpress HY-70062 MG132 MedchemExpress HY-13259 L-Glutamine Gibco 25030081 Penicillin-Streptomycin Gibco 15140122 Fetal Bovine Serum Biowest S1810 Blasticidin S HCl InvivoGen ant-bl-05 Polybrene Sigma Aldrich TR-1003-G Doxycycline hyclate Sigma Aldrich D9891 Neomycin (G418) InvivoGen ant-gn-5 Trypsin-EDTA (0.05%) ThermoFisher 25300054 rCutSmart Buffer NEB B6004S BsmBI-v2 NEB R0739S XhoI NEB R0146S Polyethyleneimine (PEI) Sigma Aldrich 408727 SsoAdvanced Universal SYBR Green Supermix BioRad 1725271 RPMI 1640 Gibco 11875093 DMEM, high glucose, no glutamine Gibco 11960044 Critical commercial assays Q5 Site-Directed Mutagenesis Kit NEB E0554S Monarch® Total RNA Miniprep Kit NEB T2010S ClarityTM Western ECL Substrate BioRad 1705060 Deposited data HEK293T NUP98::KDM5A RNA sequencing This manuscript GEO: GSE297415 murine AML SPOP-PROTAC vs. .. Empty Vector RNA sequencing This manuscript GEO: GSE297415 Tet-Off model of NUP98::KDM5A-driven murine AML cells RNA sequencing Schmoellerl et al.26 GEO: GSE134784 Mass spectrometry for the interactors of NUP98 and NUP98 oncofusions Terlecki-Zaniewicz et al.19 PRIDE: PXD022518 (Continued on next page) 16 Cell Reports 44, 116602, December 23, 2025
Mutagenesis:Article Title: Harnessing the E3 ligase SPOP for targeted degradation of the NUP98::KDM5A fusion oncoprotein.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD11b/Mac-1 BV421 (clone M1/70) Mouse mAb Biolegend Cat#101202; RRID:AB_312785 Gr-1/Ly6C BV421 (clone RB6-8C5) Mouse mAb Biolegend Cat#108433; RRID:AB_10900232 CD117/c-Kit BV421 (clone 2B8) Mouse mAb Biolegend Cat#105827; RRID:AB_10898120 Annexin V Kit PE Conjugate ThermoFisher Cat#88-8102-72; RRID:AB_2575183 V5-Tag (D3H8Q) Rabbit mAb Cell Signaling Cat#13202; RRID:AB_2687461 NUP98 (L205) Rabbit mAb Cell Signaling Cat#2288; RRID:AB_561204 β-Actin (8H10D10) Mouse mAb Cell Signaling Cat#3700; RRID:AB_2242334 SPOP Rabbit pAb Proteintech Cat#16750-1-AP; RRID:AB_2756394 OLLAS Epitope Tag (L2) Rat mAb Novus Bio CatNBP1-06713; RRID:AB_1625979 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat#7076; RRID:AB_330924 Nuclear Orange Cayman Chemical 25174 Chemicals, peptides, and recombinant proteins SPOP-IN-6b MedchemExpress HY-122615 MLN7243 (TAK-243) MedchemExpress HY-100487 MLN4924 (Pevonedistat) MedchemExpress HY-70062 MG132 MedchemExpress HY-13259 L-Glutamine Gibco 25030081 Penicillin-Streptomycin Gibco 15140122 Fetal Bovine Serum Biowest S1810 Blasticidin S HCl InvivoGen ant-bl-05 Polybrene Sigma Aldrich TR-1003-G Doxycycline hyclate Sigma Aldrich D9891 Neomycin (G418) InvivoGen ant-gn-5 Trypsin-EDTA (0.05%) ThermoFisher 25300054 rCutSmart Buffer NEB B6004S BsmBI-v2 NEB R0739S XhoI NEB R0146S Polyethyleneimine (PEI) Sigma Aldrich 408727 SsoAdvanced Universal SYBR Green Supermix BioRad 1725271 RPMI 1640 Gibco 11875093 DMEM, high glucose, no glutamine Gibco 11960044 Critical commercial assays Q5 Site-Directed Mutagenesis Kit NEB E0554S Monarch® Total RNA Miniprep Kit NEB T2010S ClarityTM Western ECL Substrate BioRad 1705060 Deposited data HEK293T NUP98::KDM5A RNA sequencing This manuscript GEO: GSE297415 murine AML SPOP-PROTAC vs. .. Empty Vector RNA sequencing This manuscript GEO: GSE297415 Tet-Off model of NUP98::KDM5A-driven murine AML cells RNA sequencing Schmoellerl et al.26 GEO: GSE134784 Mass spectrometry for the interactors of NUP98 and NUP98 oncofusions Terlecki-Zaniewicz et al.19 PRIDE: PXD022518 (Continued on next page) 16 Cell Reports 44, 116602, December 23, 2025
Article Title: Structural determinants of DANGEROUS MIX 3, an alpha/beta hydrolase that triggers NLR-mediated genetic incompatibility in plants.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-HA-Peroxidase Roche Cat # 12013819001, clone 3F10; RRID:AB_390917 Monoclonal ANTI-FLAG M2-Peroxidase (HRP) Sigma-Aldrich Cat # A8592; RRID:AB_439702 Myc-Tag (71D10) Rabbit mAb (HRP Conjugate) Cell Signaling Cat # 14038; RRID:AB_2798372 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat # 7074P2; RRID:AB_2099233 DYKDDDDK Tag Antibody Cell Signaling Cat # 2368S; RRID:AB_2217020 Anti-FLAG M2 Affinity gel Sigma-Aldrich Cat # 2220; RRID:AB_10063035 Myc-Trap Agarose ChromoTek Cat # yta-20; RRID:AB_2631369 EZview Red Anti-HA Affinity Gel Merck Cat #E6779; RRID:AB_10109562 Bacterial and virus strains Escherichia coli (E. coli) DH5α competent cell Lab stock N/A Rhizobium radiobacter (Agrobacterium tumefaciens) GV3101 Lab stock N/A E. coli BL21(DE3) RILP Lab stock N/A Chemicals, peptides, and recombinant proteins Ni-NTA resin Qiagen Cat #302030 Imidazole Bio-basic Cat #IB0277 Anti-DYKDDDDK G1 Affinity resin GenScript Cat #L00432-25 FLAG peptide Apeptide custom-made TEV protease Lab stock N/A 1GC400 copper grid GraticulesOptics 1GC400 graphene oxide Sigma-Aldrich Cat # 777676 SYPRO Orange dye Thermo Fisher Scientific Cat #S6650 L-proline-7-amido-4-methylcoumarin hydrobromide Merck Cat # 115388-93-7 KOD-plus-Neo DNA polymerase TOYOBO TOKOD-201 Gateway LR Clonase II Enzyme mix Thermo Fisher Scientific Cat # 11791020 T5 Exonuclease NEB Cat #M0363 cOmplete, EDTA-free Protease Inhibitor Cocktail Roche Cat # 11873580001 Clarity Max Western ECL Substrate Bio-Rad Cat # 1705062 Pierce 3x DYKDDDDK Peptide Thermo Fisher Scientific Cat # A36805 2x Myc-peptide ChromoTek Cat # 2yp HA peptide Thermo Fisher Scientific Cat # 26184 NativePAGE Sample Buffer (4X) Thermo Fisher Scientific BN2003 NativePAGE 5% G-250 Additive Thermo Fisher Scientific BN2004 NativePAGE 4–16% Bis-Tris protein gel Thermo Fisher Scientific BN1002BOX BN1004BOX NativeMark Unstained protein standard Thermo Fisher Scientific LC0725 Nicotinamide 1,N 6 -ethenoadenine dinucleotide Sigma-Aldrich Cat #N2630 Bovine Serum Albumin Standard Ampules Thermo Fisher Scientific Cat # 23209 2 ′ cADPR Biolog Cat #C406 3 ′ cADPR Biolog Cat #C404 Critical commercial assays QuikChange Site-Directed Mutagenesis Kit Strategene N/A (Continued on next page) e1 Molecular Cell 85, 2776–2795.e1–e8, July 17, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data DM3 Col-0 structure This paper 8JGN DM3 Hh-0 structure This paper 8JGM DM3 Col-0 EM map This paper EMD-36240 DM3 Hh-0 EM map This paper EMD-36239 FASTA, scripts of Figure 1 This paper https://doi.org/10.5281/zenodo.15671676 Experimental models: Organisms/strains N. benthamiana (Nb) Lab stock N/A Nb-eds1 Ordon et al., 2017 91 N/A Nb-nrg1 Ordon et al., 2017 91 N/A Arabidopsis: Col-0, Bla-1, Hh-0 Lab stock N/A Bla-1 dm3 This paper N/A pECNUS_JC28 in Bla-1 (Bla-1 eds1) This paper N/A 35S::DM3 Hh-0 -FLAG+pAlcA::DM2h Bla-1 - Myc in Col-0 This paper N/A pAlcA::DM2h Bla-1 -Myc in Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Y460E V484E in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 in Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A in Col-0 This paper N/A dm3 ABRC GABI_615G01 endogenous promoter::DM3 Hh-0 - FLAG/dm3 This paper N/A endogenous promoter::DM3 Col-0 - FLAG/dm3 This paper N/A Oligonucleotides Primers for cloning, see Table S2 Integrated DNA Technologies, Inc N/A Recombinant DNA pGWB514-35S::DM3 Hh-0 -HA This paper N/A pGWB514-35S::DM3 Col-0 -HA This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Y460E V484E This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 ΔC This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332R This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Q345R This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332R Q345R This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 S214A This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 S214A This paper N/A pGWB514-35S:: ΔTP DM3 Hh-0 -HA This paper N/A (Continued on next page) Molecular Cell 85, 2776–2795.e1–e8, July 17, 2025 e2
Western Blot:Article Title: Harnessing the E3 ligase SPOP for targeted degradation of the NUP98::KDM5A fusion oncoprotein.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD11b/Mac-1 BV421 (clone M1/70) Mouse mAb Biolegend Cat#101202; RRID:AB_312785 Gr-1/Ly6C BV421 (clone RB6-8C5) Mouse mAb Biolegend Cat#108433; RRID:AB_10900232 CD117/c-Kit BV421 (clone 2B8) Mouse mAb Biolegend Cat#105827; RRID:AB_10898120 Annexin V Kit PE Conjugate ThermoFisher Cat#88-8102-72; RRID:AB_2575183 V5-Tag (D3H8Q) Rabbit mAb Cell Signaling Cat#13202; RRID:AB_2687461 NUP98 (L205) Rabbit mAb Cell Signaling Cat#2288; RRID:AB_561204 β-Actin (8H10D10) Mouse mAb Cell Signaling Cat#3700; RRID:AB_2242334 SPOP Rabbit pAb Proteintech Cat#16750-1-AP; RRID:AB_2756394 OLLAS Epitope Tag (L2) Rat mAb Novus Bio CatNBP1-06713; RRID:AB_1625979 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat#7076; RRID:AB_330924 Nuclear Orange Cayman Chemical 25174 Chemicals, peptides, and recombinant proteins SPOP-IN-6b MedchemExpress HY-122615 MLN7243 (TAK-243) MedchemExpress HY-100487 MLN4924 (Pevonedistat) MedchemExpress HY-70062 MG132 MedchemExpress HY-13259 L-Glutamine Gibco 25030081 Penicillin-Streptomycin Gibco 15140122 Fetal Bovine Serum Biowest S1810 Blasticidin S HCl InvivoGen ant-bl-05 Polybrene Sigma Aldrich TR-1003-G Doxycycline hyclate Sigma Aldrich D9891 Neomycin (G418) InvivoGen ant-gn-5 Trypsin-EDTA (0.05%) ThermoFisher 25300054 rCutSmart Buffer NEB B6004S BsmBI-v2 NEB R0739S XhoI NEB R0146S Polyethyleneimine (PEI) Sigma Aldrich 408727 SsoAdvanced Universal SYBR Green Supermix BioRad 1725271 RPMI 1640 Gibco 11875093 DMEM, high glucose, no glutamine Gibco 11960044 Critical commercial assays Q5 Site-Directed Mutagenesis Kit NEB E0554S Monarch® Total RNA Miniprep Kit NEB T2010S ClarityTM Western ECL Substrate BioRad 1705060 Deposited data HEK293T NUP98::KDM5A RNA sequencing This manuscript GEO: GSE297415 murine AML SPOP-PROTAC vs. .. Empty Vector RNA sequencing This manuscript GEO: GSE297415 Tet-Off model of NUP98::KDM5A-driven murine AML cells RNA sequencing Schmoellerl et al.26 GEO: GSE134784 Mass spectrometry for the interactors of NUP98 and NUP98 oncofusions Terlecki-Zaniewicz et al.19 PRIDE: PXD022518 (Continued on next page) 16 Cell Reports 44, 116602, December 23, 2025
Article Title: Structural determinants of DANGEROUS MIX 3, an alpha/beta hydrolase that triggers NLR-mediated genetic incompatibility in plants.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-HA-Peroxidase Roche Cat # 12013819001, clone 3F10; RRID:AB_390917 Monoclonal ANTI-FLAG M2-Peroxidase (HRP) Sigma-Aldrich Cat # A8592; RRID:AB_439702 Myc-Tag (71D10) Rabbit mAb (HRP Conjugate) Cell Signaling Cat # 14038; RRID:AB_2798372 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat # 7074P2; RRID:AB_2099233 DYKDDDDK Tag Antibody Cell Signaling Cat # 2368S; RRID:AB_2217020 Anti-FLAG M2 Affinity gel Sigma-Aldrich Cat # 2220; RRID:AB_10063035 Myc-Trap Agarose ChromoTek Cat # yta-20; RRID:AB_2631369 EZview Red Anti-HA Affinity Gel Merck Cat #E6779; RRID:AB_10109562 Bacterial and virus strains Escherichia coli (E. coli) DH5α competent cell Lab stock N/A Rhizobium radiobacter (Agrobacterium tumefaciens) GV3101 Lab stock N/A E. coli BL21(DE3) RILP Lab stock N/A Chemicals, peptides, and recombinant proteins Ni-NTA resin Qiagen Cat #302030 Imidazole Bio-basic Cat #IB0277 Anti-DYKDDDDK G1 Affinity resin GenScript Cat #L00432-25 FLAG peptide Apeptide custom-made TEV protease Lab stock N/A 1GC400 copper grid GraticulesOptics 1GC400 graphene oxide Sigma-Aldrich Cat # 777676 SYPRO Orange dye Thermo Fisher Scientific Cat #S6650 L-proline-7-amido-4-methylcoumarin hydrobromide Merck Cat # 115388-93-7 KOD-plus-Neo DNA polymerase TOYOBO TOKOD-201 Gateway LR Clonase II Enzyme mix Thermo Fisher Scientific Cat # 11791020 T5 Exonuclease NEB Cat #M0363 cOmplete, EDTA-free Protease Inhibitor Cocktail Roche Cat # 11873580001 Clarity Max Western ECL Substrate Bio-Rad Cat # 1705062 Pierce 3x DYKDDDDK Peptide Thermo Fisher Scientific Cat # A36805 2x Myc-peptide ChromoTek Cat # 2yp HA peptide Thermo Fisher Scientific Cat # 26184 NativePAGE Sample Buffer (4X) Thermo Fisher Scientific BN2003 NativePAGE 5% G-250 Additive Thermo Fisher Scientific BN2004 NativePAGE 4–16% Bis-Tris protein gel Thermo Fisher Scientific BN1002BOX BN1004BOX NativeMark Unstained protein standard Thermo Fisher Scientific LC0725 Nicotinamide 1,N 6 -ethenoadenine dinucleotide Sigma-Aldrich Cat #N2630 Bovine Serum Albumin Standard Ampules Thermo Fisher Scientific Cat # 23209 2 ′ cADPR Biolog Cat #C406 3 ′ cADPR Biolog Cat #C404 Critical commercial assays QuikChange Site-Directed Mutagenesis Kit Strategene N/A (Continued on next page) e1 Molecular Cell 85, 2776–2795.e1–e8, July 17, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data DM3 Col-0 structure This paper 8JGN DM3 Hh-0 structure This paper 8JGM DM3 Col-0 EM map This paper EMD-36240 DM3 Hh-0 EM map This paper EMD-36239 FASTA, scripts of Figure 1 This paper https://doi.org/10.5281/zenodo.15671676 Experimental models: Organisms/strains N. benthamiana (Nb) Lab stock N/A Nb-eds1 Ordon et al., 2017 91 N/A Nb-nrg1 Ordon et al., 2017 91 N/A Arabidopsis: Col-0, Bla-1, Hh-0 Lab stock N/A Bla-1 dm3 This paper N/A pECNUS_JC28 in Bla-1 (Bla-1 eds1) This paper N/A 35S::DM3 Hh-0 -FLAG+pAlcA::DM2h Bla-1 - Myc in Col-0 This paper N/A pAlcA::DM2h Bla-1 -Myc in Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Y460E V484E in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 in Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A in Col-0 This paper N/A dm3 ABRC GABI_615G01 endogenous promoter::DM3 Hh-0 - FLAG/dm3 This paper N/A endogenous promoter::DM3 Col-0 - FLAG/dm3 This paper N/A Oligonucleotides Primers for cloning, see Table S2 Integrated DNA Technologies, Inc N/A Recombinant DNA pGWB514-35S::DM3 Hh-0 -HA This paper N/A pGWB514-35S::DM3 Col-0 -HA This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Y460E V484E This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 ΔC This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332R This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Q345R This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332R Q345R This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 S214A This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 S214A This paper N/A pGWB514-35S:: ΔTP DM3 Hh-0 -HA This paper N/A (Continued on next page) Molecular Cell 85, 2776–2795.e1–e8, July 17, 2025 e2
RNA Sequencing:Article Title: Harnessing the E3 ligase SPOP for targeted degradation of the NUP98::KDM5A fusion oncoprotein.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CD11b/Mac-1 BV421 (clone M1/70) Mouse mAb Biolegend Cat#101202; RRID:AB_312785 Gr-1/Ly6C BV421 (clone RB6-8C5) Mouse mAb Biolegend Cat#108433; RRID:AB_10900232 CD117/c-Kit BV421 (clone 2B8) Mouse mAb Biolegend Cat#105827; RRID:AB_10898120 Annexin V Kit PE Conjugate ThermoFisher Cat#88-8102-72; RRID:AB_2575183 V5-Tag (D3H8Q) Rabbit mAb Cell Signaling Cat#13202; RRID:AB_2687461 NUP98 (L205) Rabbit mAb Cell Signaling Cat#2288; RRID:AB_561204 β-Actin (8H10D10) Mouse mAb Cell Signaling Cat#3700; RRID:AB_2242334 SPOP Rabbit pAb Proteintech Cat#16750-1-AP; RRID:AB_2756394 OLLAS Epitope Tag (L2) Rat mAb Novus Bio CatNBP1-06713; RRID:AB_1625979 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat#7074; RRID:AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat#7076; RRID:AB_330924 Nuclear Orange Cayman Chemical 25174 Chemicals, peptides, and recombinant proteins SPOP-IN-6b MedchemExpress HY-122615 MLN7243 (TAK-243) MedchemExpress HY-100487 MLN4924 (Pevonedistat) MedchemExpress HY-70062 MG132 MedchemExpress HY-13259 L-Glutamine Gibco 25030081 Penicillin-Streptomycin Gibco 15140122 Fetal Bovine Serum Biowest S1810 Blasticidin S HCl InvivoGen ant-bl-05 Polybrene Sigma Aldrich TR-1003-G Doxycycline hyclate Sigma Aldrich D9891 Neomycin (G418) InvivoGen ant-gn-5 Trypsin-EDTA (0.05%) ThermoFisher 25300054 rCutSmart Buffer NEB B6004S BsmBI-v2 NEB R0739S XhoI NEB R0146S Polyethyleneimine (PEI) Sigma Aldrich 408727 SsoAdvanced Universal SYBR Green Supermix BioRad 1725271 RPMI 1640 Gibco 11875093 DMEM, high glucose, no glutamine Gibco 11960044 Critical commercial assays Q5 Site-Directed Mutagenesis Kit NEB E0554S Monarch® Total RNA Miniprep Kit NEB T2010S ClarityTM Western ECL Substrate BioRad 1705060 Deposited data HEK293T NUP98::KDM5A RNA sequencing This manuscript GEO: GSE297415 murine AML SPOP-PROTAC vs. .. Empty Vector RNA sequencing This manuscript GEO: GSE297415 Tet-Off model of NUP98::KDM5A-driven murine AML cells RNA sequencing Schmoellerl et al.26 GEO: GSE134784 Mass spectrometry for the interactors of NUP98 and NUP98 oncofusions Terlecki-Zaniewicz et al.19 PRIDE: PXD022518 (Continued on next page) 16 Cell Reports 44, 116602, December 23, 2025
Staining:Article Title: A combined enteric neuron-gastric tumor organoid reveals metabolic vulnerabilities in gastric cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-ACC1 Cell Signaling Cat#4190S; RRID: AB_10547752 Rabbit anti-SREBP1 Abcam Cat#ab28481; RRID: AB_778069 Rabbit anti-MLKL Abcam Cat#184718; RRID: AB_2755030 Rabbit anti-MLKL (phospho S358) Abcam Cat#187091; RRID: AB_2619685 Rabbit anti-ARHGAP26 Atlas Antibodies Cat#HPA035107; RRID: AB_10669855 Mouse anti-neuron-specific beta-III tubulin R&D systems Cat#MAB1195; RRID: AB_357520 Rabbit anti-TrkC (C44H5) Cell Signaling Cat#3376; RRID: AB_2155283 Rabbit anti-MAP2 Cell Signaling Cat#4542; RRID: AB_10693782 Rabbit GAPDH (14C10) Cell Signaling Cat#2118; RRID:AB_561053 PE/Cyanine7 anti-human CD49d antibody BioLegend Cat304313; RRID: AB_10642817 Anti-rabbit IgG, HRP-linked antibody Cell Signaling Cat#7074; RRID: AB_2099233 Goat anti-Mouse IgG (H+L) Cross-absorbed secondary antibody, Alexa Fluor TM 488 ThermoFisher Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H+L)Cross-absorbed secondary antibody, Alexa Fluor TM 568 ThermoFisher Cat#A-11011; RRID: AB_143157 ProLong TM Gold Antifade Mountant with DNA stain DAPI Invitrogen Cat#P36941; RRID: AB_2629482 Chemicals, peptides, and recombinant proteins Advanced DMEM/F12 Gibco Cat#12634010 RPMI 1640 Gibco Cat#11875093 DMEM Gibco Cat#10569010 Trypsin-EDTA Gibco Cat#25200072 HEPES Gibco Cat#15630080 GlutaMAX Gibco Cat#35050061 Penicillin-Streptomycin Gibco Cat#15140122 B-27 Supplement Gibco Cat#17504001 N-Acetyl-L-cysteine Sigma-Aldrich Cat#A9165 [Leu15]-Gastrin I human Sigma-Aldrich Cat#G9145 Recombinant Human EGF Gibco Cat#PHG0313 Recombinant Human FGF10 PeproTech Cat#100-26 Recombinant Human R-Spondin-1 PeproTech Cat#120-38 Recombinant Human Noggin PeproTech Cat#120-10C WNT Surrogate-Fc Fusion Protein IpA Cat#N001 A83-01 Tocris Cat#2939/10 Y-27632 Tocris Cat#1254/10 Cultrex Reduced Growth Factor Basement Membrane Extract, Type 2 (BME) R&D systems Cat#3533-005-02 TrypLE TM Select Gibco Cat#12563029 Matrigel Corning Cat#354277 mTESR1 StemCell Technologies Cat#85857 ReLeSR StemCell Technologies Cat#100-0484 Neurobasal medium Gibco Cat#21103049 BMP4 R&D systems Cat#314-BP-010 SB431542 R&D systems Cat#1614/10 CHIR99021 Tocris Cat#4423 Retinoic acid Tocris Cat#0695 (Continued on next page) e1 Cell Stem Cell 32, 1–19.e1–e10, October 2, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER DMH-1 Tocris Cat#4126 Essential 6 medium Gibco Cat#A1516401 CTS TM N-2 supplement Gibco Cat#A1370701 MEM Non-essential amino acids solution Gibco Cat#11140050 Recombinant human GDNF Peprotech Cat#450-10 FGF2 Stemgent Cat#03-0002 Accutase Life Technologies Cat#A11105-01 Poly-L-ornithine Merck Cat#P4957 Geltrex LDEV-Free, hESC-Qualified, reduced growth factor basement membrane matrix Gibco Cat#A1413302 Zeocin TM Invitrogen Cat#R25001 Puromycin InvivoGen Cat#ant-pr-1 Ampicillin Gold Biotechnology Cat#A30125 Opti-MEMTM Gibco Cat#31985070 PEI transfection reagent MedChemExpress Cat#HY-K2014 Dimethyl sulfoxide Sigma-Aldrich Cat#D2650 5-Fluorouracil Sigma-Aldrich Cat#F6627 IACS-010759 Cayman Cat#25867 IM-156 Cayman Cat#34763 ND630 Cayman Cat#23961 ND646 Cayman Cat#34764 Ro 48-8071 fumarate MedChemExpress Cat#HY-18630A MG-132 Sigma-Aldrich Cat#474790 Rotenone Cayman Cat#13995 TVB-2640 Cayman Cat#35703 BSA Control for BSA-Fatty Acid Complexes Cayman Cat#29556 BSA-Palmitate Saturated Fatty Acid Complex Cayman Cat#29558 BSA-Oleate Monounsaturated Fatty Acid Complex Cayman Cat#29557 Acetylcholine Merck Cat#A2661 Acetate Millipore Cat#567422 Serotonin hydrochloride MedChemExpress Cat#HY-B1473 GABA MedChemExpress Cat#HY-N0067 Dopamine hydrochloride MedChemExpress Cat#HY-B0451A VIP MedChemExpress Cat#HY-P1023 Neuropeptide Y MedChemExpress Cat#HY-P1601 Substance P MedChemExpress Cat#HY-P0201 TNF-α MedChemExpress Cat#HY-P1860 QuickExtractTM DNA Extraction Solution Biosearch Technologies Cat#QE09050 D-Luciferin, Potassium Salt Gold Biotechnology Cat#LUCK-1G Tween 80 Sigma-Aldrich Cat#P1754 PEG 400 Polysciences Cat#25322-68-3 Pierce ECL Western Blotting Substrate Thermo Scientific Cat#32106 Critical commercial assays MiniBEST Plasmid Purification Kit TaKaRa Cat#9760 Plasmid Midi Kit QIAGEN Cat#12145 DNeasy Blood & Tissue Kit QIAGEN Cat#69506 MiniBEST Universal RNA Extraction Kit TaKaRa Cat#9767 Agencourt AMPure XP beads Beckman Coulter Cat#A63881 Cell titer-Glo® Luminescent Cell Viability Assay Promega Cat#G7572 Kapa HiFi HotStart ReadyMix Kapa Biosystems Cat#KK2602 (Continued on next page) Cell Stem Cell 32, 1–19.e1–e10, October 2, 2025 e2
Membrane:Article Title: A combined enteric neuron-gastric tumor organoid reveals metabolic vulnerabilities in gastric cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-ACC1 Cell Signaling Cat#4190S; RRID: AB_10547752 Rabbit anti-SREBP1 Abcam Cat#ab28481; RRID: AB_778069 Rabbit anti-MLKL Abcam Cat#184718; RRID: AB_2755030 Rabbit anti-MLKL (phospho S358) Abcam Cat#187091; RRID: AB_2619685 Rabbit anti-ARHGAP26 Atlas Antibodies Cat#HPA035107; RRID: AB_10669855 Mouse anti-neuron-specific beta-III tubulin R&D systems Cat#MAB1195; RRID: AB_357520 Rabbit anti-TrkC (C44H5) Cell Signaling Cat#3376; RRID: AB_2155283 Rabbit anti-MAP2 Cell Signaling Cat#4542; RRID: AB_10693782 Rabbit GAPDH (14C10) Cell Signaling Cat#2118; RRID:AB_561053 PE/Cyanine7 anti-human CD49d antibody BioLegend Cat304313; RRID: AB_10642817 Anti-rabbit IgG, HRP-linked antibody Cell Signaling Cat#7074; RRID: AB_2099233 Goat anti-Mouse IgG (H+L) Cross-absorbed secondary antibody, Alexa Fluor TM 488 ThermoFisher Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H+L)Cross-absorbed secondary antibody, Alexa Fluor TM 568 ThermoFisher Cat#A-11011; RRID: AB_143157 ProLong TM Gold Antifade Mountant with DNA stain DAPI Invitrogen Cat#P36941; RRID: AB_2629482 Chemicals, peptides, and recombinant proteins Advanced DMEM/F12 Gibco Cat#12634010 RPMI 1640 Gibco Cat#11875093 DMEM Gibco Cat#10569010 Trypsin-EDTA Gibco Cat#25200072 HEPES Gibco Cat#15630080 GlutaMAX Gibco Cat#35050061 Penicillin-Streptomycin Gibco Cat#15140122 B-27 Supplement Gibco Cat#17504001 N-Acetyl-L-cysteine Sigma-Aldrich Cat#A9165 [Leu15]-Gastrin I human Sigma-Aldrich Cat#G9145 Recombinant Human EGF Gibco Cat#PHG0313 Recombinant Human FGF10 PeproTech Cat#100-26 Recombinant Human R-Spondin-1 PeproTech Cat#120-38 Recombinant Human Noggin PeproTech Cat#120-10C WNT Surrogate-Fc Fusion Protein IpA Cat#N001 A83-01 Tocris Cat#2939/10 Y-27632 Tocris Cat#1254/10 Cultrex Reduced Growth Factor Basement Membrane Extract, Type 2 (BME) R&D systems Cat#3533-005-02 TrypLE TM Select Gibco Cat#12563029 Matrigel Corning Cat#354277 mTESR1 StemCell Technologies Cat#85857 ReLeSR StemCell Technologies Cat#100-0484 Neurobasal medium Gibco Cat#21103049 BMP4 R&D systems Cat#314-BP-010 SB431542 R&D systems Cat#1614/10 CHIR99021 Tocris Cat#4423 Retinoic acid Tocris Cat#0695 (Continued on next page) e1 Cell Stem Cell 32, 1–19.e1–e10, October 2, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER DMH-1 Tocris Cat#4126 Essential 6 medium Gibco Cat#A1516401 CTS TM N-2 supplement Gibco Cat#A1370701 MEM Non-essential amino acids solution Gibco Cat#11140050 Recombinant human GDNF Peprotech Cat#450-10 FGF2 Stemgent Cat#03-0002 Accutase Life Technologies Cat#A11105-01 Poly-L-ornithine Merck Cat#P4957 Geltrex LDEV-Free, hESC-Qualified, reduced growth factor basement membrane matrix Gibco Cat#A1413302 Zeocin TM Invitrogen Cat#R25001 Puromycin InvivoGen Cat#ant-pr-1 Ampicillin Gold Biotechnology Cat#A30125 Opti-MEMTM Gibco Cat#31985070 PEI transfection reagent MedChemExpress Cat#HY-K2014 Dimethyl sulfoxide Sigma-Aldrich Cat#D2650 5-Fluorouracil Sigma-Aldrich Cat#F6627 IACS-010759 Cayman Cat#25867 IM-156 Cayman Cat#34763 ND630 Cayman Cat#23961 ND646 Cayman Cat#34764 Ro 48-8071 fumarate MedChemExpress Cat#HY-18630A MG-132 Sigma-Aldrich Cat#474790 Rotenone Cayman Cat#13995 TVB-2640 Cayman Cat#35703 BSA Control for BSA-Fatty Acid Complexes Cayman Cat#29556 BSA-Palmitate Saturated Fatty Acid Complex Cayman Cat#29558 BSA-Oleate Monounsaturated Fatty Acid Complex Cayman Cat#29557 Acetylcholine Merck Cat#A2661 Acetate Millipore Cat#567422 Serotonin hydrochloride MedChemExpress Cat#HY-B1473 GABA MedChemExpress Cat#HY-N0067 Dopamine hydrochloride MedChemExpress Cat#HY-B0451A VIP MedChemExpress Cat#HY-P1023 Neuropeptide Y MedChemExpress Cat#HY-P1601 Substance P MedChemExpress Cat#HY-P0201 TNF-α MedChemExpress Cat#HY-P1860 QuickExtractTM DNA Extraction Solution Biosearch Technologies Cat#QE09050 D-Luciferin, Potassium Salt Gold Biotechnology Cat#LUCK-1G Tween 80 Sigma-Aldrich Cat#P1754 PEG 400 Polysciences Cat#25322-68-3 Pierce ECL Western Blotting Substrate Thermo Scientific Cat#32106 Critical commercial assays MiniBEST Plasmid Purification Kit TaKaRa Cat#9760 Plasmid Midi Kit QIAGEN Cat#12145 DNeasy Blood & Tissue Kit QIAGEN Cat#69506 MiniBEST Universal RNA Extraction Kit TaKaRa Cat#9767 Agencourt AMPure XP beads Beckman Coulter Cat#A63881 Cell titer-Glo® Luminescent Cell Viability Assay Promega Cat#G7572 Kapa HiFi HotStart ReadyMix Kapa Biosystems Cat#KK2602 (Continued on next page) Cell Stem Cell 32, 1–19.e1–e10, October 2, 2025 e2
Purification:Article Title: Origin of Ewing sarcoma by embryonic reprogramming of neural crest to mesoderm.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CD99 Abcam ab108297; RRID:AB_10862996 Anti-FLI1 Abcam ab15289; RRID:AB_301825 Anti-GFP Cell Signaling mAb#2955; RRID:AB_1196614 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling 7074 S; RRID:AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling 7076 S; RRID:AB_330924 Anti-FLAG® Purified Immunoglobulin Mouse Monoclonal Antibody [M2] Millipore Sigma F3165; RRID:AB_259529 Alexa Fluor Plus 488 Goat anti-Mouse IgG Thermo Fisher A32723; RRID:AB_2633275 Alexa Fluor 546 Donkey anti-Rabbit IgG Thermo Fisher A10040; RRID:AB_2534016 Bacterial and virus strains One Shot TOP10 Chemically Competent E. coli Thermo Fisher C404003 Chemicals, peptides, and recombinant proteins Phenol Red Solution Sigma P0290-100mL 4% Paraformaldehyde Phosphate Buffer Solution FUJIFILM Irvine Scientific 163–20145 UltraPure 0.5M EDTA, pH 8.0 Thermo Fisher 15575020 Trilogy MilliporeSigma 920P Accumax TM solution Millipore Sigma (Sigma Aldrich) A7089 HEPES Buffer 0.5M, pH 8.0 Boston BioProducts BB-2080 10x HBSS Santa Cruz Biotechnology sc-391061 Bovine Serum Albumin (BSA) Millipore Sigma (Sigma Aldrich) A6003 RNAscope Probe: Hs-EWSR1-FLI1-No-XDr-C1 ACDBio Cat No. 1106251-C1 RNAscope Probe: Hs-EWSR1-FLI1-No-XDr-C4 ACDBio Cat No. 1106251-C4 RNAscope Probe: RNAscope Probe: EGFP-C1 ACDBio Cat No. 538851-C1 RNAscope Probe: Dr-ta-C1 ACDBio Cat No. 483511-C1 RNAscope Probe: Dr-ta-C2 ACDBio Cat No. 483511-C2 RNAscope Probe: Dr-nkx2.2a-C2 ACDBio Cat No. 529751-C2 RNAscope Probe: Dr-hoxd13a-C2 ACDBio Cat No. 1191371-C2 RNAscope Probe: Dr-hoxa13b-C2 ACDBio Cat No. 1129201-C2 RNAscope Probe: Dr-isl2b-C2 ACDBio Cat No. 1164341-C2 RNAscope Probe: Dr-neurog1-C2 ACDBio Cat No. 505081-C2 RNAscope Probe: Dr-elavl4-C2 ACDBio Cat No. 1056151-C2 RNAscope Probe: Dr-tbx5a-C3 ACDBio Cat No. 1183271-C3 RNAscope Probe: Dr-tbx4-C4 ACDBio Cat No. 1207821-C4 RNAscope Probe: Dr-fgf8a-C3 ACDBio Cat No. 559351-C3 RNAscope Probe: Dr-sox10-C3 ACDBio Cat No. 444691-C3 RNAscope Probe: Dr-fgf10b-C3 ACDBio Cat No. 812171-C3 RNAscope Probe: Dr-fgf10a-C4 ACDBio Cat No. 1090101-C4 RNAscope Probe: Dr-eomesa-C4 ACDBio Cat No. 1241641-C4 Opal 520 Akoya Biosciences FP1487001KT Opal 570 Akoya Biosciences FP1488001KT Opal 620 Akoya Biosciences FP1495001KT Opal 690 Akoya Biosciences FP1497001KT Critical commercial assays RNAscope Fluorescent Multiplex V2 Assay ACDBio Cat. No. 323100 (Continued on next page) Cell Reports ▪▪, 116376, ▪▪, 2025 17 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER CUT&RUN Assay Kit Cell Signaling #86652 Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle, 16 rxns 10xGENOMICS PN-1000283 Chromium Next GEM Chip J Single Cell Kit, 16 rxns 10xGENOMICS 1000230 LR Clonase TM II Plus enzyme Thermo Fisher Scientific 12538120 Gateway TM BP Clonase TM II Enzyme mix Thermo Fisher Scientific 11789020 mMESSAGE mMACHINE TM SP6 Transcription Kit Thermo Fisher AM1340 SignalStain DAB Substrate Kit Cell Signaling 8059 QIAprep Spin Miniprep Kit (250) Qiagen 27106 Deposited data Raw and analyzed data: single cell RNA and ATACseq This paper GEO: GSE63473 Raw and analyzed data: CUT&RUN This paper GEO: GSE306234 Experimental models: Organisms/strains Ubi:loxP-DsRed-STOP-loxP-GFP-2A-EF1 James Amatruda’s Lab 19 This paper − 28.5Sox10:Cre; actab2:loxP-BFPSTOP-loxP-DsRed (Sox10>dsRed) Gage Crump’s Lab N\A WIK Wild-type ZIRC N\A Oligonucleotides Morpholino: tfap2a-201e4i4 5 ′ - ACAATGAAGATCCAGCTCACCTCCT -3’ Gene Tools This Paper Morpholino: foxd3-MO 5 ′ UTR 5 ′ - CACCGCGCACTTTGCTGCTGGAGCA -3 ′ Gene Tools https://zfin.org/ZDB-MRPHLNO-060522-7 Morpholino: foxd3-MO AUG 5 ′ - CACTGGTGCCTCCAGACAGGGTCAT -3 ′ Gene Tools https://crick.zfin.org/ZDB-MRPHLNO-051220-1 Recombinant DNA pENTR5’_ubi Addgene #27320 pTol2-ubi-DsRed-stop-GFP-2A-EWSR1:FLI1 James Amatruda’s Lab 19 N/A pCS2FA Chi-Bin Chien Lab N/A pCS2-Cre.zf1 Addgene #61391 -pTol2-4.9 sox10:mTagBFP-polyA James Amatruda’s Lab This paper pTol2-4.9 sox10:Cre James Amatruda’s Lab This paper pTol2-HumanPeak-tbxtPP:mTagBFP2 James Amatruda’s Lab This paper pTol2 -tbxtPP:mTagBFP2 James Amatruda’s Lab This paper Software and algorithms Leica LAS Leica N\A Cellranger RNA 6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Cellranger ARC 2.0.0 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger-arc/latest Cellranger ATAC 2.0.0 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger-atac/latest R 4.1.3 N\A https://www.R-project.org/ Seurat 4.3.0 Stuart and Butler et al. 67 https://satijalab.org/seurat/ Signac 1.6.0 Stuart et al. 68 https://stuartlab.org/signac/ HOMER Heinz et al. 69 http://homer.ucsd.edu/homer/motif/ BEDTools Quinlan et al. 70 https://bedtools.readthedocs.io/en/latest/ SAMtools Danecek et al. 71 https://github.com/samtools/samtools GCC 8.3.0 N\A https://gcc.gnu.org/ Bowtie2 2.5.0 Langmead et al. 72 N\A (Continued on next page) 18 Cell Reports ▪▪, 116376, ▪▪, 2025 OPEN ACCESS
Virus:Article Title: Origin of Ewing sarcoma by embryonic reprogramming of neural crest to mesoderm.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CD99 Abcam ab108297; RRID:AB_10862996 Anti-FLI1 Abcam ab15289; RRID:AB_301825 Anti-GFP Cell Signaling mAb#2955; RRID:AB_1196614 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling 7074 S; RRID:AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling 7076 S; RRID:AB_330924 Anti-FLAG® Purified Immunoglobulin Mouse Monoclonal Antibody [M2] Millipore Sigma F3165; RRID:AB_259529 Alexa Fluor Plus 488 Goat anti-Mouse IgG Thermo Fisher A32723; RRID:AB_2633275 Alexa Fluor 546 Donkey anti-Rabbit IgG Thermo Fisher A10040; RRID:AB_2534016 Bacterial and virus strains One Shot TOP10 Chemically Competent E. coli Thermo Fisher C404003 Chemicals, peptides, and recombinant proteins Phenol Red Solution Sigma P0290-100mL 4% Paraformaldehyde Phosphate Buffer Solution FUJIFILM Irvine Scientific 163–20145 UltraPure 0.5M EDTA, pH 8.0 Thermo Fisher 15575020 Trilogy MilliporeSigma 920P Accumax TM solution Millipore Sigma (Sigma Aldrich) A7089 HEPES Buffer 0.5M, pH 8.0 Boston BioProducts BB-2080 10x HBSS Santa Cruz Biotechnology sc-391061 Bovine Serum Albumin (BSA) Millipore Sigma (Sigma Aldrich) A6003 RNAscope Probe: Hs-EWSR1-FLI1-No-XDr-C1 ACDBio Cat No. 1106251-C1 RNAscope Probe: Hs-EWSR1-FLI1-No-XDr-C4 ACDBio Cat No. 1106251-C4 RNAscope Probe: RNAscope Probe: EGFP-C1 ACDBio Cat No. 538851-C1 RNAscope Probe: Dr-ta-C1 ACDBio Cat No. 483511-C1 RNAscope Probe: Dr-ta-C2 ACDBio Cat No. 483511-C2 RNAscope Probe: Dr-nkx2.2a-C2 ACDBio Cat No. 529751-C2 RNAscope Probe: Dr-hoxd13a-C2 ACDBio Cat No. 1191371-C2 RNAscope Probe: Dr-hoxa13b-C2 ACDBio Cat No. 1129201-C2 RNAscope Probe: Dr-isl2b-C2 ACDBio Cat No. 1164341-C2 RNAscope Probe: Dr-neurog1-C2 ACDBio Cat No. 505081-C2 RNAscope Probe: Dr-elavl4-C2 ACDBio Cat No. 1056151-C2 RNAscope Probe: Dr-tbx5a-C3 ACDBio Cat No. 1183271-C3 RNAscope Probe: Dr-tbx4-C4 ACDBio Cat No. 1207821-C4 RNAscope Probe: Dr-fgf8a-C3 ACDBio Cat No. 559351-C3 RNAscope Probe: Dr-sox10-C3 ACDBio Cat No. 444691-C3 RNAscope Probe: Dr-fgf10b-C3 ACDBio Cat No. 812171-C3 RNAscope Probe: Dr-fgf10a-C4 ACDBio Cat No. 1090101-C4 RNAscope Probe: Dr-eomesa-C4 ACDBio Cat No. 1241641-C4 Opal 520 Akoya Biosciences FP1487001KT Opal 570 Akoya Biosciences FP1488001KT Opal 620 Akoya Biosciences FP1495001KT Opal 690 Akoya Biosciences FP1497001KT Critical commercial assays RNAscope Fluorescent Multiplex V2 Assay ACDBio Cat. No. 323100 (Continued on next page) Cell Reports ▪▪, 116376, ▪▪, 2025 17 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER CUT&RUN Assay Kit Cell Signaling #86652 Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle, 16 rxns 10xGENOMICS PN-1000283 Chromium Next GEM Chip J Single Cell Kit, 16 rxns 10xGENOMICS 1000230 LR Clonase TM II Plus enzyme Thermo Fisher Scientific 12538120 Gateway TM BP Clonase TM II Enzyme mix Thermo Fisher Scientific 11789020 mMESSAGE mMACHINE TM SP6 Transcription Kit Thermo Fisher AM1340 SignalStain DAB Substrate Kit Cell Signaling 8059 QIAprep Spin Miniprep Kit (250) Qiagen 27106 Deposited data Raw and analyzed data: single cell RNA and ATACseq This paper GEO: GSE63473 Raw and analyzed data: CUT&RUN This paper GEO: GSE306234 Experimental models: Organisms/strains Ubi:loxP-DsRed-STOP-loxP-GFP-2A-EF1 James Amatruda’s Lab 19 This paper − 28.5Sox10:Cre; actab2:loxP-BFPSTOP-loxP-DsRed (Sox10>dsRed) Gage Crump’s Lab N\A WIK Wild-type ZIRC N\A Oligonucleotides Morpholino: tfap2a-201e4i4 5 ′ - ACAATGAAGATCCAGCTCACCTCCT -3’ Gene Tools This Paper Morpholino: foxd3-MO 5 ′ UTR 5 ′ - CACCGCGCACTTTGCTGCTGGAGCA -3 ′ Gene Tools https://zfin.org/ZDB-MRPHLNO-060522-7 Morpholino: foxd3-MO AUG 5 ′ - CACTGGTGCCTCCAGACAGGGTCAT -3 ′ Gene Tools https://crick.zfin.org/ZDB-MRPHLNO-051220-1 Recombinant DNA pENTR5’_ubi Addgene #27320 pTol2-ubi-DsRed-stop-GFP-2A-EWSR1:FLI1 James Amatruda’s Lab 19 N/A pCS2FA Chi-Bin Chien Lab N/A pCS2-Cre.zf1 Addgene #61391 -pTol2-4.9 sox10:mTagBFP-polyA James Amatruda’s Lab This paper pTol2-4.9 sox10:Cre James Amatruda’s Lab This paper pTol2-HumanPeak-tbxtPP:mTagBFP2 James Amatruda’s Lab This paper pTol2 -tbxtPP:mTagBFP2 James Amatruda’s Lab This paper Software and algorithms Leica LAS Leica N\A Cellranger RNA 6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Cellranger ARC 2.0.0 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger-arc/latest Cellranger ATAC 2.0.0 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger-atac/latest R 4.1.3 N\A https://www.R-project.org/ Seurat 4.3.0 Stuart and Butler et al. 67 https://satijalab.org/seurat/ Signac 1.6.0 Stuart et al. 68 https://stuartlab.org/signac/ HOMER Heinz et al. 69 http://homer.ucsd.edu/homer/motif/ BEDTools Quinlan et al. 70 https://bedtools.readthedocs.io/en/latest/ SAMtools Danecek et al. 71 https://github.com/samtools/samtools GCC 8.3.0 N\A https://gcc.gnu.org/ Bowtie2 2.5.0 Langmead et al. 72 N\A (Continued on next page) 18 Cell Reports ▪▪, 116376, ▪▪, 2025 OPEN ACCESS
Article Title: Structural determinants of DANGEROUS MIX 3, an alpha/beta hydrolase that triggers NLR-mediated genetic incompatibility in plants.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-HA-Peroxidase Roche Cat # 12013819001, clone 3F10; RRID:AB_390917 Monoclonal ANTI-FLAG M2-Peroxidase (HRP) Sigma-Aldrich Cat # A8592; RRID:AB_439702 Myc-Tag (71D10) Rabbit mAb (HRP Conjugate) Cell Signaling Cat # 14038; RRID:AB_2798372 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat # 7074P2; RRID:AB_2099233 DYKDDDDK Tag Antibody Cell Signaling Cat # 2368S; RRID:AB_2217020 Anti-FLAG M2 Affinity gel Sigma-Aldrich Cat # 2220; RRID:AB_10063035 Myc-Trap Agarose ChromoTek Cat # yta-20; RRID:AB_2631369 EZview Red Anti-HA Affinity Gel Merck Cat #E6779; RRID:AB_10109562 Bacterial and virus strains Escherichia coli (E. coli) DH5α competent cell Lab stock N/A Rhizobium radiobacter (Agrobacterium tumefaciens) GV3101 Lab stock N/A E. coli BL21(DE3) RILP Lab stock N/A Chemicals, peptides, and recombinant proteins Ni-NTA resin Qiagen Cat #302030 Imidazole Bio-basic Cat #IB0277 Anti-DYKDDDDK G1 Affinity resin GenScript Cat #L00432-25 FLAG peptide Apeptide custom-made TEV protease Lab stock N/A 1GC400 copper grid GraticulesOptics 1GC400 graphene oxide Sigma-Aldrich Cat # 777676 SYPRO Orange dye Thermo Fisher Scientific Cat #S6650 L-proline-7-amido-4-methylcoumarin hydrobromide Merck Cat # 115388-93-7 KOD-plus-Neo DNA polymerase TOYOBO TOKOD-201 Gateway LR Clonase II Enzyme mix Thermo Fisher Scientific Cat # 11791020 T5 Exonuclease NEB Cat #M0363 cOmplete, EDTA-free Protease Inhibitor Cocktail Roche Cat # 11873580001 Clarity Max Western ECL Substrate Bio-Rad Cat # 1705062 Pierce 3x DYKDDDDK Peptide Thermo Fisher Scientific Cat # A36805 2x Myc-peptide ChromoTek Cat # 2yp HA peptide Thermo Fisher Scientific Cat # 26184 NativePAGE Sample Buffer (4X) Thermo Fisher Scientific BN2003 NativePAGE 5% G-250 Additive Thermo Fisher Scientific BN2004 NativePAGE 4–16% Bis-Tris protein gel Thermo Fisher Scientific BN1002BOX BN1004BOX NativeMark Unstained protein standard Thermo Fisher Scientific LC0725 Nicotinamide 1,N 6 -ethenoadenine dinucleotide Sigma-Aldrich Cat #N2630 Bovine Serum Albumin Standard Ampules Thermo Fisher Scientific Cat # 23209 2 ′ cADPR Biolog Cat #C406 3 ′ cADPR Biolog Cat #C404 Critical commercial assays QuikChange Site-Directed Mutagenesis Kit Strategene N/A (Continued on next page) e1 Molecular Cell 85, 2776–2795.e1–e8, July 17, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data DM3 Col-0 structure This paper 8JGN DM3 Hh-0 structure This paper 8JGM DM3 Col-0 EM map This paper EMD-36240 DM3 Hh-0 EM map This paper EMD-36239 FASTA, scripts of Figure 1 This paper https://doi.org/10.5281/zenodo.15671676 Experimental models: Organisms/strains N. benthamiana (Nb) Lab stock N/A Nb-eds1 Ordon et al., 2017 91 N/A Nb-nrg1 Ordon et al., 2017 91 N/A Arabidopsis: Col-0, Bla-1, Hh-0 Lab stock N/A Bla-1 dm3 This paper N/A pECNUS_JC28 in Bla-1 (Bla-1 eds1) This paper N/A 35S::DM3 Hh-0 -FLAG+pAlcA::DM2h Bla-1 - Myc in Col-0 This paper N/A pAlcA::DM2h Bla-1 -Myc in Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Y460E V484E in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 in Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A in Col-0 This paper N/A dm3 ABRC GABI_615G01 endogenous promoter::DM3 Hh-0 - FLAG/dm3 This paper N/A endogenous promoter::DM3 Col-0 - FLAG/dm3 This paper N/A Oligonucleotides Primers for cloning, see Table S2 Integrated DNA Technologies, Inc N/A Recombinant DNA pGWB514-35S::DM3 Hh-0 -HA This paper N/A pGWB514-35S::DM3 Col-0 -HA This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Y460E V484E This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 ΔC This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332R This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Q345R This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332R Q345R This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 S214A This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 S214A This paper N/A pGWB514-35S:: ΔTP DM3 Hh-0 -HA This paper N/A (Continued on next page) Molecular Cell 85, 2776–2795.e1–e8, July 17, 2025 e2
RNAscope:Article Title: Origin of Ewing sarcoma by embryonic reprogramming of neural crest to mesoderm.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CD99 Abcam ab108297; RRID:AB_10862996 Anti-FLI1 Abcam ab15289; RRID:AB_301825 Anti-GFP Cell Signaling mAb#2955; RRID:AB_1196614 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling 7074 S; RRID:AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling 7076 S; RRID:AB_330924 Anti-FLAG® Purified Immunoglobulin Mouse Monoclonal Antibody [M2] Millipore Sigma F3165; RRID:AB_259529 Alexa Fluor Plus 488 Goat anti-Mouse IgG Thermo Fisher A32723; RRID:AB_2633275 Alexa Fluor 546 Donkey anti-Rabbit IgG Thermo Fisher A10040; RRID:AB_2534016 Bacterial and virus strains One Shot TOP10 Chemically Competent E. coli Thermo Fisher C404003 Chemicals, peptides, and recombinant proteins Phenol Red Solution Sigma P0290-100mL 4% Paraformaldehyde Phosphate Buffer Solution FUJIFILM Irvine Scientific 163–20145 UltraPure 0.5M EDTA, pH 8.0 Thermo Fisher 15575020 Trilogy MilliporeSigma 920P Accumax TM solution Millipore Sigma (Sigma Aldrich) A7089 HEPES Buffer 0.5M, pH 8.0 Boston BioProducts BB-2080 10x HBSS Santa Cruz Biotechnology sc-391061 Bovine Serum Albumin (BSA) Millipore Sigma (Sigma Aldrich) A6003 RNAscope Probe: Hs-EWSR1-FLI1-No-XDr-C1 ACDBio Cat No. 1106251-C1 RNAscope Probe: Hs-EWSR1-FLI1-No-XDr-C4 ACDBio Cat No. 1106251-C4 RNAscope Probe: RNAscope Probe: EGFP-C1 ACDBio Cat No. 538851-C1 RNAscope Probe: Dr-ta-C1 ACDBio Cat No. 483511-C1 RNAscope Probe: Dr-ta-C2 ACDBio Cat No. 483511-C2 RNAscope Probe: Dr-nkx2.2a-C2 ACDBio Cat No. 529751-C2 RNAscope Probe: Dr-hoxd13a-C2 ACDBio Cat No. 1191371-C2 RNAscope Probe: Dr-hoxa13b-C2 ACDBio Cat No. 1129201-C2 RNAscope Probe: Dr-isl2b-C2 ACDBio Cat No. 1164341-C2 RNAscope Probe: Dr-neurog1-C2 ACDBio Cat No. 505081-C2 RNAscope Probe: Dr-elavl4-C2 ACDBio Cat No. 1056151-C2 RNAscope Probe: Dr-tbx5a-C3 ACDBio Cat No. 1183271-C3 RNAscope Probe: Dr-tbx4-C4 ACDBio Cat No. 1207821-C4 RNAscope Probe: Dr-fgf8a-C3 ACDBio Cat No. 559351-C3 RNAscope Probe: Dr-sox10-C3 ACDBio Cat No. 444691-C3 RNAscope Probe: Dr-fgf10b-C3 ACDBio Cat No. 812171-C3 RNAscope Probe: Dr-fgf10a-C4 ACDBio Cat No. 1090101-C4 RNAscope Probe: Dr-eomesa-C4 ACDBio Cat No. 1241641-C4 Opal 520 Akoya Biosciences FP1487001KT Opal 570 Akoya Biosciences FP1488001KT Opal 620 Akoya Biosciences FP1495001KT Opal 690 Akoya Biosciences FP1497001KT Critical commercial assays RNAscope Fluorescent Multiplex V2 Assay ACDBio Cat. No. 323100 (Continued on next page) Cell Reports ▪▪, 116376, ▪▪, 2025 17 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER CUT&RUN Assay Kit Cell Signaling #86652 Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle, 16 rxns 10xGENOMICS PN-1000283 Chromium Next GEM Chip J Single Cell Kit, 16 rxns 10xGENOMICS 1000230 LR Clonase TM II Plus enzyme Thermo Fisher Scientific 12538120 Gateway TM BP Clonase TM II Enzyme mix Thermo Fisher Scientific 11789020 mMESSAGE mMACHINE TM SP6 Transcription Kit Thermo Fisher AM1340 SignalStain DAB Substrate Kit Cell Signaling 8059 QIAprep Spin Miniprep Kit (250) Qiagen 27106 Deposited data Raw and analyzed data: single cell RNA and ATACseq This paper GEO: GSE63473 Raw and analyzed data: CUT&RUN This paper GEO: GSE306234 Experimental models: Organisms/strains Ubi:loxP-DsRed-STOP-loxP-GFP-2A-EF1 James Amatruda’s Lab 19 This paper − 28.5Sox10:Cre; actab2:loxP-BFPSTOP-loxP-DsRed (Sox10>dsRed) Gage Crump’s Lab N\A WIK Wild-type ZIRC N\A Oligonucleotides Morpholino: tfap2a-201e4i4 5 ′ - ACAATGAAGATCCAGCTCACCTCCT -3’ Gene Tools This Paper Morpholino: foxd3-MO 5 ′ UTR 5 ′ - CACCGCGCACTTTGCTGCTGGAGCA -3 ′ Gene Tools https://zfin.org/ZDB-MRPHLNO-060522-7 Morpholino: foxd3-MO AUG 5 ′ - CACTGGTGCCTCCAGACAGGGTCAT -3 ′ Gene Tools https://crick.zfin.org/ZDB-MRPHLNO-051220-1 Recombinant DNA pENTR5’_ubi Addgene #27320 pTol2-ubi-DsRed-stop-GFP-2A-EWSR1:FLI1 James Amatruda’s Lab 19 N/A pCS2FA Chi-Bin Chien Lab N/A pCS2-Cre.zf1 Addgene #61391 -pTol2-4.9 sox10:mTagBFP-polyA James Amatruda’s Lab This paper pTol2-4.9 sox10:Cre James Amatruda’s Lab This paper pTol2-HumanPeak-tbxtPP:mTagBFP2 James Amatruda’s Lab This paper pTol2 -tbxtPP:mTagBFP2 James Amatruda’s Lab This paper Software and algorithms Leica LAS Leica N\A Cellranger RNA 6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Cellranger ARC 2.0.0 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger-arc/latest Cellranger ATAC 2.0.0 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger-atac/latest R 4.1.3 N\A https://www.R-project.org/ Seurat 4.3.0 Stuart and Butler et al. 67 https://satijalab.org/seurat/ Signac 1.6.0 Stuart et al. 68 https://stuartlab.org/signac/ HOMER Heinz et al. 69 http://homer.ucsd.edu/homer/motif/ BEDTools Quinlan et al. 70 https://bedtools.readthedocs.io/en/latest/ SAMtools Danecek et al. 71 https://github.com/samtools/samtools GCC 8.3.0 N\A https://gcc.gnu.org/ Bowtie2 2.5.0 Langmead et al. 72 N\A (Continued on next page) 18 Cell Reports ▪▪, 116376, ▪▪, 2025 OPEN ACCESS
Multiplex Assay:Article Title: Origin of Ewing sarcoma by embryonic reprogramming of neural crest to mesoderm.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CD99 Abcam ab108297; RRID:AB_10862996 Anti-FLI1 Abcam ab15289; RRID:AB_301825 Anti-GFP Cell Signaling mAb#2955; RRID:AB_1196614 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling 7074 S; RRID:AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling 7076 S; RRID:AB_330924 Anti-FLAG® Purified Immunoglobulin Mouse Monoclonal Antibody [M2] Millipore Sigma F3165; RRID:AB_259529 Alexa Fluor Plus 488 Goat anti-Mouse IgG Thermo Fisher A32723; RRID:AB_2633275 Alexa Fluor 546 Donkey anti-Rabbit IgG Thermo Fisher A10040; RRID:AB_2534016 Bacterial and virus strains One Shot TOP10 Chemically Competent E. coli Thermo Fisher C404003 Chemicals, peptides, and recombinant proteins Phenol Red Solution Sigma P0290-100mL 4% Paraformaldehyde Phosphate Buffer Solution FUJIFILM Irvine Scientific 163–20145 UltraPure 0.5M EDTA, pH 8.0 Thermo Fisher 15575020 Trilogy MilliporeSigma 920P Accumax TM solution Millipore Sigma (Sigma Aldrich) A7089 HEPES Buffer 0.5M, pH 8.0 Boston BioProducts BB-2080 10x HBSS Santa Cruz Biotechnology sc-391061 Bovine Serum Albumin (BSA) Millipore Sigma (Sigma Aldrich) A6003 RNAscope Probe: Hs-EWSR1-FLI1-No-XDr-C1 ACDBio Cat No. 1106251-C1 RNAscope Probe: Hs-EWSR1-FLI1-No-XDr-C4 ACDBio Cat No. 1106251-C4 RNAscope Probe: RNAscope Probe: EGFP-C1 ACDBio Cat No. 538851-C1 RNAscope Probe: Dr-ta-C1 ACDBio Cat No. 483511-C1 RNAscope Probe: Dr-ta-C2 ACDBio Cat No. 483511-C2 RNAscope Probe: Dr-nkx2.2a-C2 ACDBio Cat No. 529751-C2 RNAscope Probe: Dr-hoxd13a-C2 ACDBio Cat No. 1191371-C2 RNAscope Probe: Dr-hoxa13b-C2 ACDBio Cat No. 1129201-C2 RNAscope Probe: Dr-isl2b-C2 ACDBio Cat No. 1164341-C2 RNAscope Probe: Dr-neurog1-C2 ACDBio Cat No. 505081-C2 RNAscope Probe: Dr-elavl4-C2 ACDBio Cat No. 1056151-C2 RNAscope Probe: Dr-tbx5a-C3 ACDBio Cat No. 1183271-C3 RNAscope Probe: Dr-tbx4-C4 ACDBio Cat No. 1207821-C4 RNAscope Probe: Dr-fgf8a-C3 ACDBio Cat No. 559351-C3 RNAscope Probe: Dr-sox10-C3 ACDBio Cat No. 444691-C3 RNAscope Probe: Dr-fgf10b-C3 ACDBio Cat No. 812171-C3 RNAscope Probe: Dr-fgf10a-C4 ACDBio Cat No. 1090101-C4 RNAscope Probe: Dr-eomesa-C4 ACDBio Cat No. 1241641-C4 Opal 520 Akoya Biosciences FP1487001KT Opal 570 Akoya Biosciences FP1488001KT Opal 620 Akoya Biosciences FP1495001KT Opal 690 Akoya Biosciences FP1497001KT Critical commercial assays RNAscope Fluorescent Multiplex V2 Assay ACDBio Cat. No. 323100 (Continued on next page) Cell Reports ▪▪, 116376, ▪▪, 2025 17 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER CUT&RUN Assay Kit Cell Signaling #86652 Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle, 16 rxns 10xGENOMICS PN-1000283 Chromium Next GEM Chip J Single Cell Kit, 16 rxns 10xGENOMICS 1000230 LR Clonase TM II Plus enzyme Thermo Fisher Scientific 12538120 Gateway TM BP Clonase TM II Enzyme mix Thermo Fisher Scientific 11789020 mMESSAGE mMACHINE TM SP6 Transcription Kit Thermo Fisher AM1340 SignalStain DAB Substrate Kit Cell Signaling 8059 QIAprep Spin Miniprep Kit (250) Qiagen 27106 Deposited data Raw and analyzed data: single cell RNA and ATACseq This paper GEO: GSE63473 Raw and analyzed data: CUT&RUN This paper GEO: GSE306234 Experimental models: Organisms/strains Ubi:loxP-DsRed-STOP-loxP-GFP-2A-EF1 James Amatruda’s Lab 19 This paper − 28.5Sox10:Cre; actab2:loxP-BFPSTOP-loxP-DsRed (Sox10>dsRed) Gage Crump’s Lab N\A WIK Wild-type ZIRC N\A Oligonucleotides Morpholino: tfap2a-201e4i4 5 ′ - ACAATGAAGATCCAGCTCACCTCCT -3’ Gene Tools This Paper Morpholino: foxd3-MO 5 ′ UTR 5 ′ - CACCGCGCACTTTGCTGCTGGAGCA -3 ′ Gene Tools https://zfin.org/ZDB-MRPHLNO-060522-7 Morpholino: foxd3-MO AUG 5 ′ - CACTGGTGCCTCCAGACAGGGTCAT -3 ′ Gene Tools https://crick.zfin.org/ZDB-MRPHLNO-051220-1 Recombinant DNA pENTR5’_ubi Addgene #27320 pTol2-ubi-DsRed-stop-GFP-2A-EWSR1:FLI1 James Amatruda’s Lab 19 N/A pCS2FA Chi-Bin Chien Lab N/A pCS2-Cre.zf1 Addgene #61391 -pTol2-4.9 sox10:mTagBFP-polyA James Amatruda’s Lab This paper pTol2-4.9 sox10:Cre James Amatruda’s Lab This paper pTol2-HumanPeak-tbxtPP:mTagBFP2 James Amatruda’s Lab This paper pTol2 -tbxtPP:mTagBFP2 James Amatruda’s Lab This paper Software and algorithms Leica LAS Leica N\A Cellranger RNA 6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Cellranger ARC 2.0.0 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger-arc/latest Cellranger ATAC 2.0.0 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger-atac/latest R 4.1.3 N\A https://www.R-project.org/ Seurat 4.3.0 Stuart and Butler et al. 67 https://satijalab.org/seurat/ Signac 1.6.0 Stuart et al. 68 https://stuartlab.org/signac/ HOMER Heinz et al. 69 http://homer.ucsd.edu/homer/motif/ BEDTools Quinlan et al. 70 https://bedtools.readthedocs.io/en/latest/ SAMtools Danecek et al. 71 https://github.com/samtools/samtools GCC 8.3.0 N\A https://gcc.gnu.org/ Bowtie2 2.5.0 Langmead et al. 72 N\A (Continued on next page) 18 Cell Reports ▪▪, 116376, ▪▪, 2025 OPEN ACCESS
other:
Protease Inhibitor:Article Title: Structural determinants of DANGEROUS MIX 3, an alpha/beta hydrolase that triggers NLR-mediated genetic incompatibility in plants.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-HA-Peroxidase Roche Cat # 12013819001, clone 3F10; RRID:AB_390917 Monoclonal ANTI-FLAG M2-Peroxidase (HRP) Sigma-Aldrich Cat # A8592; RRID:AB_439702 Myc-Tag (71D10) Rabbit mAb (HRP Conjugate) Cell Signaling Cat # 14038; RRID:AB_2798372 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Cat # 7074P2; RRID:AB_2099233 DYKDDDDK Tag Antibody Cell Signaling Cat # 2368S; RRID:AB_2217020 Anti-FLAG M2 Affinity gel Sigma-Aldrich Cat # 2220; RRID:AB_10063035 Myc-Trap Agarose ChromoTek Cat # yta-20; RRID:AB_2631369 EZview Red Anti-HA Affinity Gel Merck Cat #E6779; RRID:AB_10109562 Bacterial and virus strains Escherichia coli (E. coli) DH5α competent cell Lab stock N/A Rhizobium radiobacter (Agrobacterium tumefaciens) GV3101 Lab stock N/A E. coli BL21(DE3) RILP Lab stock N/A Chemicals, peptides, and recombinant proteins Ni-NTA resin Qiagen Cat #302030 Imidazole Bio-basic Cat #IB0277 Anti-DYKDDDDK G1 Affinity resin GenScript Cat #L00432-25 FLAG peptide Apeptide custom-made TEV protease Lab stock N/A 1GC400 copper grid GraticulesOptics 1GC400 graphene oxide Sigma-Aldrich Cat # 777676 SYPRO Orange dye Thermo Fisher Scientific Cat #S6650 L-proline-7-amido-4-methylcoumarin hydrobromide Merck Cat # 115388-93-7 KOD-plus-Neo DNA polymerase TOYOBO TOKOD-201 Gateway LR Clonase II Enzyme mix Thermo Fisher Scientific Cat # 11791020 T5 Exonuclease NEB Cat #M0363 cOmplete, EDTA-free Protease Inhibitor Cocktail Roche Cat # 11873580001 Clarity Max Western ECL Substrate Bio-Rad Cat # 1705062 Pierce 3x DYKDDDDK Peptide Thermo Fisher Scientific Cat # A36805 2x Myc-peptide ChromoTek Cat # 2yp HA peptide Thermo Fisher Scientific Cat # 26184 NativePAGE Sample Buffer (4X) Thermo Fisher Scientific BN2003 NativePAGE 5% G-250 Additive Thermo Fisher Scientific BN2004 NativePAGE 4–16% Bis-Tris protein gel Thermo Fisher Scientific BN1002BOX BN1004BOX NativeMark Unstained protein standard Thermo Fisher Scientific LC0725 Nicotinamide 1,N 6 -ethenoadenine dinucleotide Sigma-Aldrich Cat #N2630 Bovine Serum Albumin Standard Ampules Thermo Fisher Scientific Cat # 23209 2 ′ cADPR Biolog Cat #C406 3 ′ cADPR Biolog Cat #C404 Critical commercial assays QuikChange Site-Directed Mutagenesis Kit Strategene N/A (Continued on next page) e1 Molecular Cell 85, 2776–2795.e1–e8, July 17, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data DM3 Col-0 structure This paper 8JGN DM3 Hh-0 structure This paper 8JGM DM3 Col-0 EM map This paper EMD-36240 DM3 Hh-0 EM map This paper EMD-36239 FASTA, scripts of Figure 1 This paper https://doi.org/10.5281/zenodo.15671676 Experimental models: Organisms/strains N. benthamiana (Nb) Lab stock N/A Nb-eds1 Ordon et al., 2017 91 N/A Nb-nrg1 Ordon et al., 2017 91 N/A Arabidopsis: Col-0, Bla-1, Hh-0 Lab stock N/A Bla-1 dm3 This paper N/A pECNUS_JC28 in Bla-1 (Bla-1 eds1) This paper N/A 35S::DM3 Hh-0 -FLAG+pAlcA::DM2h Bla-1 - Myc in Col-0 This paper N/A pAlcA::DM2h Bla-1 -Myc in Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Y460E V484E in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A in Bla-1 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 in Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A in Col-0 This paper N/A dm3 ABRC GABI_615G01 endogenous promoter::DM3 Hh-0 - FLAG/dm3 This paper N/A endogenous promoter::DM3 Col-0 - FLAG/dm3 This paper N/A Oligonucleotides Primers for cloning, see Table S2 Integrated DNA Technologies, Inc N/A Recombinant DNA pGWB514-35S::DM3 Hh-0 -HA This paper N/A pGWB514-35S::DM3 Col-0 -HA This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Y460E V484E This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332A Q345A N349A This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 ΔC This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332R This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 Q345R This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 D332R Q345R This paper N/A pGWB515-35S::HA-ΔTP DM3 Hh-0 S214A This paper N/A pGWB515-35S::HA-ΔTP DM3 Col-0 S214A This paper N/A pGWB514-35S:: ΔTP DM3 Hh-0 -HA This paper N/A (Continued on next page) Molecular Cell 85, 2776–2795.e1–e8, July 17, 2025 e2
|